r - How to split large dataframe by columns and write into individual CSVs -


i have large csv file new.dat 100s of column names. want split new.dat per column names keeping first column in new subset written .csv.

new.dat 

new.dat <- structure(list(sequence = c("aaaaaacctgttctgata", "aaaaaaggctgttactgagc",  "aaaaacattcgagcgagatctct", "aaaaacctcgacttcggaag", "aaaaagctcgtagttgaa",  "aaaaagctcgtagttgaac"), wt1 = c("84", "104", "80", "35", "112",  "350"), wt2 = c("149", "478", "502", "186", "577", "911"), ago1 = c("32",  "147", "433", "51", "258", "353"), ago2 = c("37", "222", "355",  "85", "408", "420"), dcl1 = c("56", "185", "291", "48", "167",  "273"), dcl2 = c("59", "176", "294", "31", "185", "245"), nas = c(0l,  0l, 0l, 0l, 0l, 0l)), .names = c("sequence", "wt1", "wt2", "ago1",  "ago2", "dcl1", "dcl2", "nas"), row.names = c(na, 6l), class = "data.frame")

so result new.dat data should have 7 csv files. first csv wt1.csv sequence , wt1 columns, second csv file wt2.csv sequence , wt2 columns , forth..

this code have tried. please suggest missing here. thanks

for (name in colnames(new.dat[-1])){    tmp=subset(new.dat$sequence, colnames==name)    fn= name    #save csv file     write.csv(tmp,fn,row.names=false)  }

we can loop on column names except first 1 lapply, subset columns of dataset including 'sequence' column , write file

lapply(names(new.dat)[-1], function(nm)     write.csv(new.dat[c("sequence", nm)],         paste0(nm, ".csv"), quote = false, row.names = false))

Comments

Post a Comment

Popular posts from this blog

resizing Telegram inline keyboard -

telegram's inline keyboard great feature lots of different use cases. inline buttons added list of items this: inline_keyboard = [[inlinekeyboardbutton(text="button", callback_data="button"), inlinekeyboardbutton(text="reset",callback_data="reset")]] inline_keyboard_markup = inlinekeyboardmarkup(inline_keyboard) update.message.reply_text("hi", reply_markup=inline_keyboard_markup) the above code adds 2 buttons each half width of chat screen. i know the normal keyboard button there resize_keyboard parameter somehow can used. my question is there way resize inline buttons ? example make full width or quarter width. unfortunately, can't now. :( you can suggest @botsupport , might add feature next version.
Read more

command line - How can a Python program background itself? -

consider following python command-line program. doesn't work because incomplete, think illustrates problem: #!/usr/bin/python3 import multiprocessing pool = multiprocessing.pool() task in expensive_iterator_with_user_interaction(): pool.call_async(expensive_computation, (task,)) pool.close() print("dear user, may press ctrl-z , bg script.") pool.join() thus, problem scripts needs user input while it's launching expensive parallel processes. there moment when user interaction not needed anymore. then, ask user background process shell actions. however, can achieved program itself? (side note: core of problem entanglement of user input firing “expensive computations”. therefore, cannot separate both in 2 scripts, , letting 1 spawning other daemon.) the command screen may you. use screen -l create new session , run application. after inputting data, can press " ctrl-a " , press " d " on keyboard detach session. now
Read more

php - "cURL error 28: Resolving timed out" on Wordpress on Azure App Service on Linux -

Image
my wordpress installation on azure app service on linux using custom docker container has slow response times. pages take around 20-40 seconds load. i have troubleshooting plugin installed indicates problem "curl error 28: resolving timed out after n milliseconds" when making requests following urls https://api.wordpress.org/core/version-check/1.7/ http://api.wordpress.org/core/version-check/1.7/ https://api.wordpress.org/plugins/update-check/1.1/ http://api.wordpress.org/plugins/update-check/1.1/ https://api.wordpress.org/themes/update-check/1.1/ http://api.wordpress.org/themes/update-check/1.1/ curl works fine on scm-site command line. example works ok. curl -x post http://api.wordpress.org/core/version-check/1.7/ edit if ssh container , run php code, works fine. <?php $url = 'http://api.wordpress.org/core/version-check/1.7/'; $fields = array( 'version' => urlencode('4.8.1'), 'php' => urlencode(
Read more